Human Variation & Race

Mark Glen
Anthro 101
10/16/2012

Race Variation

     Humans ability to maintain homeostasis relative to environmental heat is a rather difficult task. Heat at temperatures too high affect us in that it not only damages our skin, it also causes internal damage as well. As a natural reaction to heat, we sweat. However, if the weather is hot and dry then humidity will be low, causing sweat to readily evaporate. Initially that sounds like a good thing, but when analysis extends a bit further we find that through this ready evaporation, we rapidly produce the loss of bodily water and salts just by sweating. If those minerals aren't sufficiently replenished, then the heat can potentially be fatal in less than a day. Now that's how it affects us internally, what it does externally is burn our skin.This mostly affects people with paler skin complexions and less melanin prepared to protect the skin. The burning will cause redness of the affected area, peeling of the skin that has been burned, and pain when the area is touched. 

•      Sweating, it's our bodies way of naturally cooling off when it is hot. If there is event he slightest breeze of wind, our skin will be cooled when it meets our sweat. Also, it soaks into our clothing, giving us and even further amount of cooling.

 

•      A facultative adaptation to heat would be the body's ability to tan when it's exposed for too long to the sun.

 

•      Melanin/darker skin and bipedalism are the two greatest developmental adaptations to heat. The darker skin complexions can withstand the heat more efficiently than people with pale skin. They can stand the heat longer and naturally it doesn't cause much or any harm to them. Bipedalism is everyone's adaptation to heat in that it brings us up from the ground where heat is immediately being extracted from and it allows us to expose a tremendously lower amount of our body to the sun. 

•      As for cultural adaptations, we have incorporated large bodies of water to get into like pools or oceans. We now even have swamp coolers that can do the job for us if we live in a modern, enclosed house.

     In benefit we learn how to cope with heat, how to avoid being damaged by it or possibly killed by it. Explorations like this are helpful in many ways. Example, studying our homeostasis relative to the haet conditions in the Sahara show us what we need to do to survive there. Or any other hot place on our planet, it give us the power to keep our race (human) alive when under these conditions.

     To help someone understand the variations of adaptations to heat based on race I would explain how black people have melanin in their skin that helps then withstand the heat and white people didn't develop the same way. However, they do tan during the summer time when it is most hot out in order to avoid damage by the sun. (no offense to anyone). Well, when you use race to explain adaptation variations you separate people the single "human race" that we are and put them into sub-categories, as if to be totally different species. To clarify and explain that the only reason we have different phenotypic adaptations is that every environment is different brings us back to unity. When it's explained this way, it makes the listener understand the relation we have to our environment and that its the stresses we undergo over long periods of time that shape our adaptations, not the race that we are born into.

    

Language & Communications

Mark Glen
10/9/2012
Anthro 101


Part 1: You were asked to engage in a conversation for 15 minutes where you were not allowed to use any version of a symbolic language (no speaking, writing, or ASL).

• Did you find this experiment difficult or easy? Explain. (5 pts)

•  What were the impressions of partners in the conversation? Did they alter their way of communicating with you because of your absence of symbolic communication? Describe. (5 pts)

•  Imagine that you and your partners in the conversation represent two different cultures meeting for the first time. Which culture has the advantage in communicating complex ideas? What attitudes might the speaking culture have toward the culture that does not use symbolic language? Identify individuals in our culture that have difficulty communicating with spoken language and explore how that affects how those who do speak interact with those individuals. (10 pts) 

     In the experiment of limited communication, I found it to be quite difficult to express my thoughts fully. Initially, I thought that since I know how to communicate, as I do it everyday, this would be easy. When I tried to express myself through gestures, I began to realize that I'd have to emit a lot more effort than with speaking along. I also realized that in order for the group I was communicating with to understand what I was trying to tell them, they'd need some sort of background of my form of communication; which they didn't have.
    
     The impressions that they had left me with were of confusion. They had only a slight idea of what I was trying to tell them, and even then they still had parts of information incorrect. They way they spoke to me at first was how they'd normally speak. After many failed efforts of being able to comprehend what I was communicating back to them, they began to speak at a more remedial level, hoping that my response would be more easily understandable.

     If we were two different cultures meeting for the first time, the culture with the ability to speak and identify objects by a commonly used name, and incorporate body language into their communication would be able to communicate complex ideas. This complex culture may perceive the non-symbolic speaking culture as more ignorant or more inferior. Their lower level of intelligence would be more easily detected among a culture that can speak to their own and communicate complex ideas. The first set of individuals that have a difficulty communicating spoken language in our own culture, are babies and toddlers. When they communicate with adults, they use mostly body language; they point, grab our hands and pull us to their desires, they tap our legs and look into the direction they want us to go. However, when we speak to them, we don't use fully complex and incomprehensible terminology; we speak at a very basic and understandable level. We point to objects and address them by using "one word" phrases, we will often repeat the word to the child and press their hand against the object so that they can identify it in the future. Then there are some individuals who cannot hear or speak and rely solely on their ability to communicate with bodily gestures. With them it becomes more challenging. While they're fully capable of comprehending a language, they can't hear the language being spoken around them, so it becomes almost impossible. So we use gestures to communicate back with them. This is how we've developed sign language.


Part 2: You were asked to spend 15 minutes communicating without any physical embellishments, i.e., no hand signals, not vocal intonation, not head, facial, or body movements.

•  Were you able to last for the full 15 minutes of using only speech for communicating? What made this experiment difficult for you? (5 pts)

•  How were your partners in this part of the experiment affected by your communication limitations? Explain. (5 pts)

•  What does this experiment say about our use of “signs” in our language, i.e., how important is non-speech language techniques in our ability to communicate effectively? (5 pts)

•  Are there people who have difficulty reading body language? Describe the adaptive benefit to possessing the ability to read body language. Can you describe environmental conditions where there might be a benefit to not reading body language? (5 pts)

     When I started to speak with no tone emphasis and no other form of expression, it seemed possible. After a few minutes of speaking that way I wasn't able to continue; I started to slightly use some intonation. Being that I am very expressive when I speak, it came naturally when I started to speak normally. What made this the most difficult for me was, forcing myself out of my comfort zone. Sitting very still, not nodding my head to suit the expression of my words, holding my facial muscles still when they're naturally programmed to curve over my words and to keep my hands on my lap without implying seriousness or firmness of my points almost made me feel alien to my own body.

     During the time where my communication was limited, my partners began to laugh. Eventually they calmed down and when they asked me questions, they were "straight to the point" questions. I noticed that they had gone from detailed and elaborate questions, to ones with fewer words and required a conclusion with fewer words.

     This experiment has shown me that in order to communicate an idea effectively, the possession of the ability to speak well and  the use of bodily gestures as emphasis for your words is required. We are beings who express ideas to one another because of the passion we have for them. Without the body gestures, our passion begins to wither. Words can only carry our message so far, it's the difference in tone and pitch, the movement of limbs and facial muscles that our corespondent's attention thrives off of.

     Yes, some people do have difficulty reading body language. Though I believe it is rare, it's still possible. Being able to read body language also gives you the ability to comprehend invasive ideas, i.e., if a woman is emotionally hurt and is expressing her pain to you, but you can't read body language, then her tears and palms pressed to her eyes will have no effect on how you perceive her idea. So being able to read body language really is a sign of being intelligent. If environmental conditions (for whatever reason) prohibited people from speaking face to face and we were only allowed to speak via telephone or email, then we'd have no benefit for being able to read body language. Body language is only effective to the interpreter when he/she is within visibility of the communicator.

Piltdown hoax - Essay

Mark Glen
9/25/2012
Anthro 101

      The Piltdown hoax was a great deception on the science world that occurred during the early end of the 1900's in Piltdown, East Sussex, England. An amateur archaeologist, Charles Dawson, had supposedly found artifacts of an earlier humanoid ancestor while digging in a gravel pit. He immediately began to construct a team of only the best scientists in that region; England's leading geologist Arthur Smith Woodward, French paleontologist Father Pierre Teilhard de Chardin, and England's leading anatomist and Woodward's best supporter, Arthur Keith. Together, these men discovered what has become known as the Piltdown man. The Piltdown man was a fake all along, but it took the world of science 40 years to discover its fraud.

     Indeed, by nature, humans have faults and in this situation, many of them were displayed. Archaeologist Charles Dawson was a man who sought fame and notoriety, he wanted to be nationally recognized for his scientific contributions. So his self-interest was the fuel that propelled his drive and motives. It caused him to lie among his colleagues, cheat with artificially stained evidence, and deceive the entire science world. Though his "findings" were accepted at first, they were thrown out when science was proficient enough to properly and thoroughly check their genuineness.

     Finally, in 1949, when science had the appropriate tools to properly date fossils, a full analysis of the Piltdown man artifacts was conducted. Scientists began with Florine tests, which by measuring the Florine contents of fossils they'd be able to roughly estimate a date for them. They discovered that the jaw-bone was less than 100 years old and belonged to a female orangutan and not a human. It wasn't until a few years later in 1953 that they realized the bones were artificially stained, cut and shaped with a steel knife, and its teeth were filed down. A man named Martin Hinton who was a volunteer worker at the time had more bones in a trunk that were dyed the same way as the bones of the Piltdown man. Scientists were able to tell tell the parallel consistencies by engineering an identical process of dying other bones and producing the same result.

     The human-factors that cause errors such as the previously mentioned to occur, also cause tremendous discoveries for science. I believe it is impossible to entirely make the human-factor obsolete. They can definitely be reduced, however, they're naturally occurring passions. For instance; jealousy, persistence, desperation, and impatience all have the potential to drive motivation, but it's the individual that decides what path to steer the vehicle. So I would, as much as possible, try to reduce the human-factor.

     Taking data at face value with unverified sources can be very dangerous, especially in science. To be recognized as a reliable scientist source, you have to be prepared to present a sound argument for your discoveries, this means your claim must be able to support your conclusion and both must be falsifiable. An entire project can be disregarded or stopped altogether if the sources of data are unsustainable. My advice is, to make matters convenient on yourself, verify your sources and thoroughly analyze your experiments, because the facts and credibility depend on both the analysis and source verification.

Comparative Primate Blog Post

Mark Glen
Anthro 101
9/19/2012

LEMURS:

a) Lemurs are typically found out in the wild, in what is known as the Old World. ie; Europe, Asia and
Africa. However, they are exclusively native to the Madagascar and Comoro Islands territory.

b) Diet: They are herbivores. They eat fruit and leaves, sometimes even eat insects (mostly the smaller lemurs).

c) Lemurs can be prey to many other animals, so to stay high up in the trees and at mid-level puts a limit on what they can eat. At that level they have iifruits, leaves and insects. This dietary conformity is a direct influence from iiitheir environment, making it an adaptation.


SPIDER MONKEY:

a) They live in the tropical forests of Southern Mexico to Brazil, found in Central and South America.

b) They're herbivores; they eat leaves, fruit, nuts, gums and occasionally insects.

c) This primate isn't much bigger than the other animals that surround its environment. So it isn't preying on many things. It's inability to kill large animals leaves its menu very short, so it has adapted to eating fruits and nuts.


BABOON:

a) They're found in Africa. They sleep in trees or on cliff faces, spend their days in grasslands searching for food while in large groups.

b) They're omnivores; they eat both meat and fruit. In fact, large baboons eat other monkeys, chimpanzees and flamingos.

c) Since they are not in trees throughout the day and are big enough to eat other medium sized animals, fruits and nuts do not satisfy their hunger or nutrition. They also require meat. The way they've adapted to hunting for meat is to hunt in large groups, they also have elongated and very sharp canine teeth.


GIBBON:

a) They're found in Southeast Asia.

b) Omnivores; eat both meat and fruit. They eat plants, leaves, flowers, seeds, tree bark, tender plant shoots, insects, spiders, bird eggs and small birds.

c) They rarely go to the ground and since they are so well equipped to swing through the trees, they are rarely caught by prey. They stay up in the trees at a level where they can easily access bids and their eggs and fruits and leaves. This is how they've adapted to their environment.


CHIMPANZEE:

a) They're found in Western and Central Africa, from the Atlantic coast to the inlands.

b) Omnivores; they eat meat, plants, fruits, seeds, tree bark, plant bulbs, tender plant shoots, flowers, termites, ants, small animals. They even drink water. Their method for obtaining the water is to chew up a leaf and sop up the water like a sponge.

c) Chimpanzees are among the primates that show signs of intelligence. A testiment to this is how they drink their water. They've developed a step by step method to get their H2o, similar to how infants entering their toddler stages begin to form step by step plans to achieve their goals. They aren't likely to be prey all of the time, but they do need to prey on other, smaller animals to reach their nutritional satisfaction.
In totality, they've all evolved in simiar ways. They all eat fruits and plants, all live in trees, and none of them are incapable of being prey. However, some of the primates grew to be larger, causing them to require more nutrition than nuts alone can offer. So they've adapted to eating meat. They grew larger, sharper teeth, and developed tactics and strategies for hunting. Most of them, having to survive in the trees, have just adapted to and settled with only eating fruits, herbs and birds.

Homologous vs Analogous Traits

Mark Glen
Anthro 101
9/13/2012

Homologous:

Humans vs Bats -

a)
 Humans and bats both possess forelimbs. Though both species are mammal, the forelimb provides a different function for each species.

b)
Structure and function of the human forelimb (hand particularly) is designed for grasping and possesses five fingers. The hand of the bat also has five fingers, but is unable to grasp. However, they have webbing in between to equip them with the ability to fly. The two display differences as a result of adaptation to different environments and speciation.

c)
The common ancestor between the two was an 80 million year old shrew-like species. Scientists have discovered this through computer analysis; reading evolution backwards and putting together a large portion of this species' genotype.  http://www.nytimes.com/2004/12/07/science/07paleo.html

d)

Analogous:

Butterfly vs Bird -

a)
Butterfly wings are much smaller, much weaker and much more fragile. Bird wings are much bigger, much heavier and can carry much more weight.

b)
The wings on birds are constructed of many bones, muscles that cover them, and feathers that cover the muscle. They are simply a second set of legs, only adapted for flying. Butterfly wings don't have feathers, rather, they have scales. Each species has adapted wings to carry them to destinations through the air. Butterflies transport themselves from flower to flower and birds from tree to tree. For each this is a form of survival. Butterflies need to be close to the ground to drink fluids and close to flowers for their pollen. Whereas birds become prey if they are unable to get higher than their predators, so they rest high up in the trees.

c)
There are no common ancestors between birds and butterflies, despite having adapted wings that serve the same purpose.

d)

DNA Strand

Mark Glen
Anthro 101
9/6/2012

DNA STRAND

GTAATACCTTTAAGGTAGTGTTAGCGTCCGGTGAATCCTAG

Charles Darwin vs. Jean-Baptiste Lamarck

 Mark Glen      

Anthro 101

1)         Jean-Baptiste Lamarck was in similarity with Charles Darwin in that they were both evolutionists. However, Lamarck proposed evolution through natural processes over fifty years before Darwin would become well known for his book Origin of Species. So in that respect, Darwin was influenced in a positive way.

 2)       Though Jean-Baptiste Lamarck was not very well respected among his colleagues for his contributions to science, he did however leave an imprint on the science world as a whole. His strong belief was that evolution occurs over a long period of time, due to nature's requirement of particular traits from the subject. Elaborately, if an animal's environment changes, the animal will be forced to adapt to the changes. Over time (generations), the animal's offspring will have become more equipped with the trait that is most often used and those that aren't used as often will have either shrunk or disappeared entirely. Either way his colleagues felt about his proposal, it was still eventually a great contribution to science.
                    -    http://www.ucmp.berkeley.edu/history/lamarck.html

3)        "If the environment changes, the traits that are helpful or adaptive to that environment will be 

different." 

      Lamarck believed that, if a parent animal's behavior began to change that it was because of the result of environmental changes. With him there was no survival of the fittest because there was no extinction. His belief was simple yet complex; the changes that the parent had undergone would be improved alterations to their traits and therefore passed down to their children. Darwin was more elaborate in his beliefs about animals changing to survive with the environment. This belief was even simpler and more feasible; subjects with more pre-adapted traits we selected to survive by the environment, simply because they possessed the ability to. Hence, they were able to produce offspring with their traits and continue the survival of a species. 

         "Individuals do not evolve.  Populations do."

         Lamarck, in believing that small environmental changes occur that make the subject adapt, in turn also believed that evolution occurred in the individual first. That the adapted changes would become woven into the fabric of inheritance and continue to evolve the species into a more complex and perfect one. Again, Darwin did partially agree with Lamarck, but in being elaborate, he furthered his study and made more sense of the idea that small changes took place and were passed down. To him, small changes did indeed occur, but randomly on their own; not as the result of some environmental change. Those changes that are proven to be necessary for the host's survival will remain with its host. All other changes will eventually disappear and be discarded. -Natural selection.

4)     I do believe that Darwin could have made his theory of Natural Selection without the works of Jean-Baptiste Lamarck. Darwin's approach when studying was of more common-sense and was more feasible. He's demonstrated that animals do adapt to their environments, just like Lamarck did. However, he also showed that this occurrence is a random event. If the environment caused evolution within generations, our world would be over populated because no species would ever die off, younger generations would have noticeable differences among their parents and grandparents.

5)    Darwin always had respect for the church and even attended a local church regularly. However, the church didn't agree with his outlook on the evolving man. They saw man as one of the many designs of God. Whereas Darwin, having the opportunity to study the history of man began to doubt that he was of a design instead of a product of natural survival. When he published his book Origin of Species, he was still not in disbelief that there was a god, he just had doubts. As he was claimed to have been an atheist he cleared the air and announced that he was really just agnostic.